Web Input

Why is your email address required?

Your email address is required to send bipad output back to you. You should make sure the email address entered is correct in order for the bipad server to send your results to a right destination. Even though you choose to print your results online, the requirement is still valid for user verification. As a guest you only receive your results via email regardless of your output options.

The registered users be permitted access to the server only if the electronic mail addresses are assigned by their employers or in the case of students, their academic affiliations. We reserve the right to deny access to guests who use anonymous addresses or third party mail servers (eg. google, yahoo, hotmail etc.). We will not harvest the addresses and use them for commercial or marketing purposes, and will not monitor the research that users are conducting on the bipad web server.

What is your password?

The password will be created and sent to you upon your completion of registration. As a guest visitor, you don't need to register and the password is not required.

How to name a project?

Your project title is required to name this bipad run. The title will also be used as the title of the sequence logo generated on the fly if your result display is online suppose that you are a registered user.

What is a bipartite search pattern?

A search pattern can be either single-block or bipartite. You can set one pattern each run. Note that the search pattern specified is your hypothetic model to be built by Bipad. It should be based on your biological observation or published information related to the problem you are looking at. We recommend that you try a little wider motif than your thought and then progressively refine your model by adjusting your motif widths and gap ranges based on the sequence logo or bipad output you generated. The Bipad web server currently does not automate this refinement procedure. Therefore it is up to the user who controls the searching scheme. Obviously an improper search pattern may lead to a biologically meaningless motif model.

A bipartite pattern (see illustration below) is an independent functional unit on the upstream or downstream of a co-regulated gene, which is often recognized by a homodimer or heterodimer protein complex. A bipartite search pattern can be expressed as JL<[dmin, dmax]>JR.

Widths: JL, JR, the widths of the first and second motifs respectively. The minimum width allowed is 4 bps and the maximum width is 23 bps.
Gaps: dmin - minimum gap, dmax - maximum gap size. The minimum gap allowed is 0 and max is 20 bps.
The limitation could be relaxed based upon request.

A single-block can be thought of as zero-gap bipartite pattern where two motifs are merged into one.

If it is a single-block, then the JL is picked as the homogeneous motif width and JR, dmin and dmax are ignored. If it is a bipartite (two-block), you are required to set all values of JL, JR, dmin and dmax.

Bipad spends about double time on bipartite pattern search than on one-block motif search.

What is an alignment mode?

Bipad outputs motif models based upon optimal multiple local alignment which may be performed either on forward strand or both strands. The alignment mode should be in agreement with your biological problem or hypothesis: motifs may be located on one strand only or either strands. It takes bipad more time with both strands aligment to complete your job than for single strand alignment mode.

Cycles of run

The default is 10 cycles. If 10 cycles are not enough to converge, you shall increase the cycles. The maximum cycle number allowed is 500 due to limited web server capacity. If more than max cycle is needed, please contact the authors. Remember that the more cycles you set, the longer you need to wait for your results.

Fine tuning of width

The default is tune-off. If switch on fine-tuning, the specified width will become the core, Bipad will make a batch of runs and draw a UII graph. The maximum tuning width is set to 24 bps.

DNA sequences: FASTA format

To enter your own sequence, you can either copy and paste into the text area or type in directly. Sequences should be consisted of {A,C,G,T, 1-9}. You can use number to count the rows of mucleotides. Upper and lower case are equivalent, and characters other than {A, C, G, T and 1-9} are illegal and may cause bipad program halted. Sequences can also be uploaded as FASTA file format.

Here is the FASTA format example:

>CE1CG
TAATGTTTGTGCTGGTTTTTGTGGCATCGGGCGAGAATAGCGCGTGGTGTGAAAGACTGT
TTTTTTGATCGTTTTCACAAAAATGGAAGTCCACAGTCTTGACAG

>ECOARABOP
GACAAAAACGCGTAACAAAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTT
GCACGGCGTCACACTTTGCTATGCCATAGCATTTTTATCCATAAG

Note that sequences containing repeats of low complexity, such as poly-A or poly-T, should be masked before submitted. The maximum length of a sequence is 200 bps and the maximum number of sequeces each time you submit is 200. The maximum total length of the sequence set is 40,000 bps. Your sequences are kept in our server for one day. These limitation could be relaxed upon your request.

Sequence model: OOPS or ZOOPS?

The default sequence model is OOPS (one bipartite site occurence per sequence in the dataset). You also could choose ZOOPS (zero or one bipartite site occurence per sequence) as an option.

How many bases flanking a motif?

Residues upstream and downstream of motifs. Flanking bases are in lowercase and motifs are printed in uppercase. Flanking bases will not be showed in a sequence logo due to map size limit. If your flanking bases are out of bound, bipad takes the boundary values which results in printing a full alignment. As defaults, there are no flanking bases.

What is output/result options?

Results can be displayed either online or sent to you by email depending on your options. The default is to email your result.